Data from Lunardon et al. (2020)

Annotations viewer

Genome

Version v0 of Nicotiana tabacum cv. K326 from The Sol Genomics Network

Warning: Undefined array key "loc_type" in /data/www/html/multiannotations.php on line 42

Locus type

Annotation source

Name contains:

Family contains:

Name	Genome	Coordinates	Strand	Reads	RPM	Major RNA	Family	Locus Type	Annotation Source
TAS3a-FH434354_Tang2012	Nicotiana tabacum (Tobacco) 0	Ntab-K326_AWOJ-SS109749:15300-16099	.	13,631	68.02	UUCUUGACCUUGUAAGACCCC		siRNA21	Tang_et_al_2012