Data from Lunardon et al. (2020)

Annotations viewer

Genome

Version 3.0 genome build from Phytozome 10 along with plastid and mitochondrial genomes

Locus type

Annotation source

Name contains:

Family contains:

Name	Genome	Coordinates	Strand	Reads	RPM	Major RNA	Family	Locus Type	Annotation Source
ppt-MIR901	Physcomitrella patens (Spreading Earthmoss) 3.0	Chr13:3937397-3937617	.	4,617	31.66	UGAUGGCAGCUAGGAUUUAAGAGG	miR901	siRNA24	miRBase21