Data from Lunardon et al. (2020)

Annotations viewer

Genome

Version 3.0 genome build from Phytozome 10 along with plastid and mitochondrial genomes

Locus type

Annotation source

Name contains:

Family contains:

Name	Genome	Coordinates	Strand	Reads	RPM	Major RNA	Family	Locus Type	Annotation Source
ppt-MIR1063g	Physcomitrella patens (Spreading Earthmoss) 3.0	Chr19:10199265-10199575	+	6,844	46.93	GAUGCAGAACUGCAAGAAGU	miR1063	siRNA20	miRBase21
ppt-MIR1063d	Physcomitrella patens (Spreading Earthmoss) 3.0	Chr22:9278038-9278393	-	8,283	56.80	GAUGCAGAACUACAAGAAGC	miR1063	siRNA20	miRBase21